Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN307
Clone ID RRN307
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN307
Sequence
CTTTTTTTCTTCGGCAGCAGATGCTGCACGCACAGACTTTTCACAGTGATTCTCTGCTGAGTCAGGAAGAGGCTGCAGCT
GCCGGGGACTGGAGGCCAGCGCCT
Sequence Type mRNA
Unitrap ID UNI7807

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 117866752..117866843 86
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017715 (Pgs1) NM_133757 phosphatidylglycerophosphate synthase 1 Gene [Source:MGI (curated);Acc:Pgs1-001]

 
Come back to gene ENSMUSG00000017715


For any suggestions or comments, please send an email to unitrap@crg.es