Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST119500
Clone ID OST119500
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST119500
Sequence
GCCTGAGCCGGGCTGGGCTCCCATTTGGGTTGATGCGCCGGGAGCTAGCATGNGAGGGCTACCCCATCGAGCTGCGGTGC
CCGGGGAGTGATGTCATCATAGGTGGTGGCAAACGGGCAGGATGAGTATTTAATAAAAGTTCGCAAGTTTCCAAAAAA
Sequence Type mRNA
Unitrap ID UNI26406

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 86442719..86442823 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013033 (Lphn1) NP_851382 latrophilin 1 Gene [Source:MGI Symbol;Acc:MGI:1929461]

 
Come back to gene ENSMUSG00000013033


For any suggestions or comments, please send an email to unitrap@crg.es