Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST119399
Clone ID OST119399
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST119399
Sequence
GACGTCTGGGGAGCTCCTGCATTAAGTCAGACTGAGCCTCTTCAGTCTGTCAAGTTGAACCTGTGGGAAGATGGTTTGAA
GCTTTTGTTAAGAGGAGAAACAGAAATGCTTCTACATCTTTTCAGGAACTGGAAGATAAGAAAGAGTTGTCAGAGGAATC
AGAAGATGAAGAGTTACAGTTAGAAGAATTCCCCATGCTGAAAACACTTGATCCCAAAGATTGGAAGAATCAAGATCATT
ATGCGGTTCTTGGACTTGGCCACGTCAGATACACAGCTACACAGAGACAGATCAAAGCAGCTCATAAAGCAATGGTCTTG
AAACATCATCCAGACAAACGGAAAGCGGCTGGGGAACCCATCAAAGAAGGAGACAATGACTACTTCACTTGCATAACTAA
AGCTTATGAAATGTTGTCTGATCCAGTGAAAAGGCGGGCATTTAACAGTGTAGATCCTACTTTTGACAACTCAGTTCCTT
CTAAAAGTGAAGCTAAGGACAATTTTTTTTCAAGNGTTTTCTCCAGTGTTTGAAAGGAATTCAAGATGGTCAAATAAAAA
AAA
Sequence Type mRNA
Unitrap ID UNI13088

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 21279659..21289057 193
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029014 (Dnajc2) NM_009584 DnaJ (Hsp40) homolog, subfamily C, member 2 Gene [Source:MGI (curated);Acc:Dnajc2-006]

 
Come back to gene ENSMUSG00000029014


For any suggestions or comments, please send an email to unitrap@crg.es