Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN339
Clone ID RRN339
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN339
Sequence
GGTCATTGGCGGCTCCCAAGATGGCGTCCATCGTGGAAGGGCCGCTGAGCAAATGGACTAACGTGATGAAGGGATGGCAG
TATCGTTGGTTCGTGCTGGACTACAATGCAGGGCTGCTCTCCTACTACACGTCCAAGGACAAAATGATGAGAGGCTCTCG
AAGAGGATGCGTTAGACTCAGA
Sequence Type mRNA
Unitrap ID UNI7451

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 108844879..108874839 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028559 (Osbpl9) NM_133885 oxysterol binding protein-like 9 Gene [Source:MGI (curated);Acc:Osbpl9-001]

 
Come back to gene ENSMUSG00000028559


For any suggestions or comments, please send an email to unitrap@crg.es