Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST119312
Clone ID OST119312
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST119312
Sequence
CTTTGGAAGAAGAACCAGGATGACTTTGAGTGTGTGACCACTCTTGAGGGCCATGAAAATGAGGTCAAGTCAGTGGCTTG
GGCCCCATCTGGCAACCTCTTGGCTACCTGCAGCAGAGATAAGAGCGTGTGGGTCTGGGAAGTTGATGAAGAGGATGAGT
ATGAGTGTGTCAGTGTCCTCAGCTCTCATACGCAGGATGTTAAGCACGTGGTTTGGCACCCGAGCCAGGAGCTTTTAGCT
TNTGCTAGCTATGATGACACAGNGAAGCTATACCAGGAAGAAGGGGATGACTGGG
Sequence Type mRNA
Unitrap ID UNI26416

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 127071597..127072774 116
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000003662 (Ciao1) NM_025296 cytosolic iron-sulfur protein assembly 1 homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ciao1-001]

 
Come back to gene ENSMUSG00000003662


For any suggestions or comments, please send an email to unitrap@crg.es