Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST119309
Clone ID OST119309
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST119309
Sequence
GACGTCTGGGGAGCTCCTGCATTAAGTCAGACTGAGNGTAAAAAGNGGATCAGGCAGNTCATATGCTAAAGGATGGCACG
GTCANNATCCAGATCCCCCAGGTGGAAACAAAGGTCATTATCGCCACANTCTAGAAATTTTGAATACCATGAGGAAAGAC
ATTTCCATGGGCACTATGACCCTGAATATAGACATGATCAACAAAGACCCTTTACTTGGAGAATGGATGATGAAAAACAT
GGACAAAATAAACCAAGGATTCCCCCTCG
Sequence Type mRNA
Unitrap ID UNI12940

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 155986169..155989838 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044150 (A830080D01Rik) NM_001033472 RIKEN cDNA A830080D01 gene Gene [Source:MGI Symbol;Acc:MGI:2685992]

 
Come back to gene ENSMUSG00000044150


For any suggestions or comments, please send an email to unitrap@crg.es