Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST119132
Clone ID OST119132
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST119132
Sequence
GACTGAGAAAGAGTAGTTGAGCAGCTGCGCAGAACCTGATAGTCAAACAAGAGCAGCCGGACAAGTTCCAGATACAGCCA
TTGTCACAGTCTGAAAACAAACTACAAACAGCACAGCAGCAGCCACTACAGCCACTGC
Sequence Type mRNA
Unitrap ID UNI26419

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 92160387..92160518 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000058318 (Phf21a) NM_138755 PHD finger protein 21A Gene [Source:MGI (curated);Acc:Phf21a-002]

 
Come back to gene ENSMUSG00000058318


For any suggestions or comments, please send an email to unitrap@crg.es