Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone CH0238
Clone ID CH0238
Vector pGT0lxr
Project sanger

Sequence tag CH0238
Sequence
TTAAGGTGGATGTTGAGAAGCAGATGCCCAATAAGCATGAGCATGTTATCCGGTGCCGACTTTGCAATCGGCAACGCTGT
CTATATGATGCCCTCATGGCACAGATTGTAACTAAGGAGACACTAGCTACAGGCCATTTTATGAGTGTCATCAACATTCT
GATGCAGTTGCGGAAAGTCTGCAATCATCCAAATCTATTTGACCCTCGACATGTTACCTCCCCGTTCATCACTCCAGGCA
TCTGCTTTAGCACCGCCTCTCTGGTTCTAAGGGCCACTGAAGTTCATCCTCTCCAG
Sequence Type mRNA
Unitrap ID UNI804

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 134678090..134678475 183
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053877 (Srcap) Snf2-related CREBBP activator protein Gene [Source:MGI Symbol;Acc:MGI:2444036]

 
Come back to gene ENSMUSG00000053877


For any suggestions or comments, please send an email to unitrap@crg.es