Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRN384
Clone ID RRN384
Vector pGT0Lxf
Project baygenomics

Sequence tag RRN384
Sequence
AGAAGGAAGAAGAGAACTTGACTGTGAAGTCTAAGAAAAGGCATAGCCTGGCTATTGGGGACAAAGTCACTGGGACCATT
AAGGCTGTGAAGGCCACACATGTTGTTGTAACCCTAGCTGATGGCTTTGTTGGCTGTATCCATGCCTCCCGCATCTTAGA
TGATGTCCCAGTGGGCACCTCGCCTACGACCACACTGAAAGCCGGGAAGAAAGTCACTGCGAGAGTGATCGGTGGGCGAG
ATGTGAAGACATCTAAGTTTCTCCCAATAAGTCACCCCAGATTTGTTCTGACCATCCTGGAGCTGAGTGTTCGGCCAAGT
GAGTTGAAGGGTAGCTACAGTGCTCTTAATACTCACTCTGAGAGCCCCGTGGAGAAGATCAGGCAGTACCAGGCTGGGCA
GACTGTGACCTGCTTCTTCAAGA
Sequence Type mRNA
Unitrap ID UNI7816

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47187950..47191890 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025047 (Pdcd11) NM_011053 programmed cell death 11 Gene [Source:MGI Symbol;Acc:MGI:1341788]

 
Come back to gene ENSMUSG00000025047


For any suggestions or comments, please send an email to unitrap@crg.es