Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST118909
Clone ID OST118909
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST118909
Sequence
GTCTGGGGAGCTCCTGCATTAAGTCAGACTGAGTCCTAACAGGGGCTTTACAGAAATGCACTGTATGAGCGGCCACTCTA
ATTTTGTGNCTTGTGTGTGTATCATACCCTCAAGTGACATATATCCTCATGGACTGATTGCCACTGGAGGAAATGACCAC
AATATTTGCATTTTCTCGCTGGACAGTCCAATGCCACTTTATATTTTAAAGGGTCACAAAGATACTGTTTGTAGTCTTTC
TTCTGGAAAATTTGGGACATTACTTAGTGGCTCATGGGACACCACTGCTAAAGTCTGGCTGAATGACAAATGCATGATGA
CATTACAGGGTCATACAGCCCGCAGTATGGGCAGTAAAGATTTTACCTGAACAGGGCTTAATGCTAACTGGATCAGCAGA
CAAGACCATTAAACTATGGAAGGCTGGAAGATGTGAGAGGACTTTTTTAGGGCATGAAGACTGTGTAAGAGGCTTGGCAA
TCTTGAGTGAGACAGAATTTCTTTCCTGTGCAAACGATG
Sequence Type mRNA
Unitrap ID UNI24093

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 94253543..94256767 194
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028577 (Plaa) NM_172695 phospholipase A2, activating protein Gene [Source:MGI (curated);Acc:Plaa-001]

 
Come back to gene ENSMUSG00000028577


For any suggestions or comments, please send an email to unitrap@crg.es