Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST118842
Clone ID OST118842
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST118842
Sequence
TGAGGTGATGCTGGGAGCAGAACTCCAAAAGNCCAGAAGCTTCGTGAAGCTATGGCTGCCTTAAGAAAATCAGCTCAAGA
TGTCCAGAAGTTCATGGATGCTGTCAACAAGAAAAGCAGTTCTCAAGATCTACATAAAGGAACCTTGGGTCAGGTGTCTG
GAGAACTGAGCAAAGATGGGGACCTGATAGTCAGCATGCGGATTCTGGGCAAGAAGAGGACTAAGACATGGCACAAAGGC
ACCCTTATTGCCATCCAGACTGTTGGNCTAGGANTANAATACAGAGTGAANGACTGACNACCAAGGACCNAGTNTGCTAT
CCAGGGAACCATAGTGNCTATNATNACCACCCTTCCGCTNACTATGCTGNTTGAGGACANCCGANTGGTGNCCAAGTACA
AAGATGGAAATCANGCCTGGCTTTATGCTGG
Sequence Type mRNA
Unitrap ID UNI26429

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95150576..95153797 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015697 (Setdb1) NM_018877 SET domain, bifurcated 1 Gene [Source:MGI (curated);Acc:Setdb1-005]

 
Come back to gene ENSMUSG00000015697


For any suggestions or comments, please send an email to unitrap@crg.es