Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST118785
Clone ID OST118785
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST118785
Sequence
GAACTGAGGTTGCTTCTATAACTGGATCACGAGTTTGCTGCACAAAGTACCATGTCTCGATCCCGGCAGCCCCCACTTGC
GTGAGCTGTGNCNTCCATAGNANGGATGTCTAGGAATCAGATCCCANAGAGNCCCGGGAAGGACCCNANCACNCTGACCA
CNATNCANACCTGCTGTNGCTGNTCNTNGACCTTNATCAAATCCTATGTNAAGAGGGCGTNTTGTAAGGACGGAAGGAAN
ATTACCCTGGGANAAGCNAATGNAANTTGGGCTTTANTATTGTCACAACTAAGGTTGGGNTGTAAAGGAANCTCAACTGT
CTCTTTTAAGCTACTCAAGCCTGAAAAAATAGGCATTTTAGATCAGTCTGCAGTGTGGGTGGATGAAATGAATTATTATG
ATATGCGGACTGACAGGAACAAAGGGATTCCTCCCTTGTCTCT
Sequence Type mRNA
Unitrap ID UNI25539

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 31027400..31032641 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021357 (Exoc2) NM_025588 exocyst complex component 2 Gene [Source:MGI (curated);Acc:Exoc2-001]

 
Come back to gene ENSMUSG00000021357


For any suggestions or comments, please send an email to unitrap@crg.es