Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST118725
Clone ID OST118725
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST118725
Sequence
GACTGAGGTTACCATCTGTCCAAGACGGAGGTCATGAAGAACACCCTCAACCCGGTGTGGCAAACCTTCTCCATCCCCGT
GAGGGCTCTGTGCAACGGAGACTATGACAGGACCATCAAGGTGGAGGTGTATGACTGGGATCGTGACGGCAGCCATGACT
TCATTGGGGAGTTCACCACCAGCTACCGGGAGCTGGCACGTGGCCAGAGTCAGTTCAACATCTATGAGGTGATAAATCCA
AAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI22186

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29306382..29320974 100
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024008 (Cpne5) NM_153166 copine V Gene [Source:MGI (curated);Acc:Cpne5-001]

 
Come back to gene ENSMUSG00000024008


For any suggestions or comments, please send an email to unitrap@crg.es