Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST118603
Clone ID OST118603
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST118603
Sequence
CGGCGTGGAGCTGCCTGCTCATTNAGTTCTGNCACGGCNCACCTGCTGTGAACCTGAGGAGCACACACACTGTCGCACNN
TTCTACTGNACCAAGAGATTATNCGANAGAGAATCGGNNTCCNCTCCCCCTTCCTTCATAACTGGNAGNCAGGAACAANA
NAACTTGAGCCTTGNTCACACATGNGAAGCCAGCACACTACGACTTGGACAGGCTCTGCCCGTCCTTCCTCCAGGTGAGG
GGTGGCTCTACAGGCTTGGCTTAAAGTCTGAAGATGCTGTGCTGTGACAAATATATATGACCCTTGACCTACAAAAAAAA
AA
Sequence Type mRNA
Unitrap ID UNI26433

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 56905162..56905294 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000007603 (Dus3l) NM_144858 dihydrouridine synthase 3-like (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2147092]

 
Come back to gene ENSMUSG00000007603


For any suggestions or comments, please send an email to unitrap@crg.es