Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRP045
Clone ID RRP045
Vector pGT0Lxf
Project baygenomics

Sequence tag RRP045
Sequence
GGAGCAAGAGCACAACAATCTGGTCAATGTCCCTCTCCGTGTGGATATGTGTCTCAACTGGCTTCTCTAATGTTTATGAT
ACGGGACGAACAGGGAGGATCCGTGTCCTGTCTTTTAAAACTGGCATCATTTCTCTGTGTAAAGCACACTTGGAAGACAA
GTACAGATACCTTTTCAAGCAAGTGGCAAGTTCAACTGGCTTTTGTGACCAGCGTAGGCTGGGTCTTCTTCTGCATGATT
CTATTCAAATCCCAAGACAGTTGGGTGAAGTTGCTTCCTTTGGGGGCAGTAACATTGAGCCGAGTGTCAGGAGCTGCTTC
CAATTT
Sequence Type mRNA
Unitrap ID UNI4390

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 82350604..82355439 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000045103 (Dmd) NM_007868 dystrophin, muscular dystrophy Gene [Source:MGI (curated);Acc:Dmd-001]

 
Come back to gene ENSMUSG00000045103


For any suggestions or comments, please send an email to unitrap@crg.es