Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM391
Clone ID RRM391
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM391
Sequence
ATTATTAACTCTTTTCAAAGTATTAGTCAAGAAATGGAAGTTTACACACCCAAGTTAACTCAGGTTCTCTCAAGCAGTGC
TGCTAGTAGCACCATCACAGCCCTGTCACCTGGAGGAGCTCTTATGCAGGGAGGAACACAGCAAGCCGTAAACCAGATGG
TGCCAAACGATATTCAGTCTGAATTGAAACACTTGTATGTGGCTGTTGGGGAACTTCTGCGGCATTTTTGGTCTTGCTTT
CCTGTTAATACACCATTCCTAGAAGAAA
Sequence Type mRNA
Unitrap ID UNI7830

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 54070725..54072380 114
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006599 (Gtf2h1) NM_008186 general transcription factor II H, polypeptide 1 Gene [Source:MGI (curated);Acc:Gtf2h1-001]

 
Come back to gene ENSMUSG00000006599


For any suggestions or comments, please send an email to unitrap@crg.es