Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST118028
Clone ID OST118028
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST118028
Sequence
GATCTGAGGTGCCTCCGTCGACTGTGGAGTACCTGGNGAAAACAAGGCATTATGTGCGGGTCCTCCAGACAGAGCAGGCC
GTGAAGGAGTATAATGCCTTGGNTGCCCAAGGGGNCAGGGTAGGAGGTGTCTTCCATTCCACCTGCTGATGGCGCCTACN
GAGGAGAATAAATCAGACCACAAAGCCTTGGCTGTCTTACCAGTCTCCAAAAAAC
Sequence Type mRNA
Unitrap ID UNI13793

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 104699051..104699253 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035642 (1810020D17Rik) NM_183251 RIKEN cDNA 1810020D17 gene Gene [Source:MGI Symbol;Acc:MGI:1913523]

 
Come back to gene ENSMUSG00000035642


For any suggestions or comments, please send an email to unitrap@crg.es