Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST117985
Clone ID OST117985
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST117985
Sequence
GACTGAGGTACTCACAGAGAACTGGTATTGAAGGGAGGCCCATACGATGGAATATGAAATATAAA
Sequence Type mRNA
Unitrap ID UNI26440

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 82499962..82500021 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028403 (Zdhhc21) NM_026647 zinc finger, DHHC domain containing 21 Gene [Source:MGI (curated);Acc:Zdhhc21-001]

 
Come back to gene ENSMUSG00000028403


For any suggestions or comments, please send an email to unitrap@crg.es