Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST117799
Clone ID OST117799
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST117799
Sequence
CTGAGGGTTCCGGCGCTNCCCGTGAAAAACTNGAATGGCACTGGCCCTGTNCACCCAGCCTTGCTCAGGGNTGACCGNGA
TNCTGCTGTGTGCAGCGTAGCTGCCGANGTGCCTGACACGAGCACCCAAACCCATCCTGCACCCACCACCAGTANGCAAA
AGCNACTGTNGAAGCCTGTGCCTGNAGTGCCCGGNGTGTGCCGAAAGACCAANAAAAAACACCTCAAGAAAAAGCAAGAA
TCCTGAGGATGTGGTTCGGAGGTACATGCAGAAGGTGAAAAACCCCGCCTGATGAGGACTGTACCATTTTGCATGGGAGC
GGCTGNTCACAGNATCTGGGCTATGAGGGCGTGCTCCGAAAACAAGAGTGTGCGGNCCGAGCTTGTGGGCCGNCTGGGCC
GTNGGGGNCANATGTATCACNTGGNTCTGNCTGGNGGCCATGTACTCCAATGGCAAAAAGGA
Sequence Type mRNA
Unitrap ID UNI26444

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 121132588..121133759 131
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029603 (Dtx1) NM_008052 deltex 1 homolog (Drosophila) Gene [Source:MGI (curated);Acc:Dtx1-001]

 
Come back to gene ENSMUSG00000029603


For any suggestions or comments, please send an email to unitrap@crg.es