Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRP067
Clone ID RRP067
Vector pGT0Lxf
Project baygenomics

Sequence tag RRP067
Sequence
TTATGGGTTTGAAAGAACTTCGACAGCAAGTCAGAACCTTAGAAGAGCACTGGCAGCGTCACTTAGCTCGAACTTCTGGA
AGATGGAAAGACCCACCCAAGAAAAATGCTGTGAATGAGTTACAGGATGAGCTGATGAGCATTCGCCTTAGAGAGGCGGA
AACACAGGCAGAAATAAGAGAGATGAAGCAAAGGATGATGGAAATGGAGACA
Sequence Type mRNA
Unitrap ID UNI7843

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 108224721..108226887 158
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000011831 (Evi5) NM_007964 ecotropic viral integration site 5 Gene [Source:MGI (curated);Acc:Evi5-001]

 
Come back to gene ENSMUSG00000011831


For any suggestions or comments, please send an email to unitrap@crg.es