Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST117529
Clone ID OST117529
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST117529
Sequence
GACTGAGGTTCTCACNCGGCNTTTTGGCCTCTTCCACTCCTATCATGTACTGGTTTCCAGCTCACCTGCTTCAGGATCAA
GANCCGCTGCTGAGGTGTGTGGACACAGAGCCTGGGAAGCTTCCTCAGGAGAAGCCCCCACCAGGACAGAAGGCCCCCAG
AAACTGCCTCATGAAACTCTTCTACANATTGGGAAGAGCTGCTCGCCAGTCACAAGATGCGTTCTGGTCTACTTCCTGAC
CTACTGGCTTCTGGGACTAATTCTCCATTGCAACTTCCTGCCTTGGACTTGACCTGGAGTGTCAAGGGTTGAAAGCTCTA
AGACGACACCCTGGCTGGGACAGCCCGCACACTCCGGAGAGCACTGTGCAGTAGGATCTCTTGGGTCTCTCTGGGGGCCA
GCTAANAAGGGAAAATGGGAGCACAGGCGCCCCTTCTCATCCTGGGCCGGGGCAGGTGTAGGGGGAGTAACTTCAGTGCT
CAGTGCAGGGGTCTCAAATCTCCCTAGTCCACAAGTACTAGGCAATCTTAAACCCTACTAC
Sequence Type mRNA
Unitrap ID UNI14099

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 133218180..133218708 484
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000043257 (Pigv) NM_178698 phosphatidylinositol glycan anchor biosynthesis, class V Gene [Source:MGI (curated);Acc:Pigv-002]

 
Come back to gene ENSMUSG00000043257


For any suggestions or comments, please send an email to unitrap@crg.es