Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST117003
Clone ID OST117003
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST117003
Sequence
ATACTGATTCTCTGATTTCCCAGTAATGCCACTCAGTTGCCAATATCAAGCAAGCGCATATAAGACACTTGTAATCTTTT
AAGAAAAGTAGTACTTCTCTTCACAGTATCTGGCGGATCAACACTGGAGGGTGAGGTGTCAGCTTCCAGAAAGATCATCA
TGAAGTTATATGTGTTTCTGGTTAACACCGGAACCACGCTGACATTTGACACTGAGCTAACTGTGCAAACTGTGGCTGAT
NTTAAGCATGCCATTCAAAGCAAATACAAGATTGCTATTCAGCACCAGGTTCTGGTGGTCAATGGAGGAGAATGCATGGC
TGCAGATCGAAGAGTGTGTACTTACAGCGCTGGGACGGACACAAATCCAATTTTTCTTTTTAATAACAGAAATGATCTTA
TTGAAAG
Sequence Type mRNA
Unitrap ID UNI21564

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 6218021..6224352 127
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025907 (Rb1cc1) NM_009826 RB1-inducible coiled-coil 1 Gene [Source:MGI Symbol;Acc:MGI:1341850]

 
Come back to gene ENSMUSG00000025907


For any suggestions or comments, please send an email to unitrap@crg.es