Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST116905
Clone ID OST116905
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST116905
Sequence
GGCAACTGACTTTCCTAATGTTTGGTGGCTATGAGACTATAGAAGCATTTGAAGATGATCTTTATCGTGATGATTCATCT
AGTGAACTGAGTGTTGATAGTGAGGTGGAATTTCAGCTCTACAGCCTAGTCCATTATGCCCAGAGTATACATAATGCCAA
CAAGGAGGAAGGATATGAGGAAAAGAACTGTGAGAATTCGGANACAGTGAGTAGTCAACCAAATCAGAAGAACTTAATCG
TCCTTTCAGATAGTGAGGNCATCCANCTATCTGATACATCAGAGGTCATCACATTATCTGATGAAGATAGTATTTATAGA
TGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI18137

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 44774728..44775062 321
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035649 (Zcchc7) NM_177027 zinc finger, CCHC domain containing 7 Gene [Source:MGI (curated);Acc:Zcchc7-003]

 
Come back to gene ENSMUSG00000035649


For any suggestions or comments, please send an email to unitrap@crg.es