Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST116859
Clone ID OST116859
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST116859
Sequence
GATGACGTCCATATCTTNTCGNAAGAGAGGGAATCAGAAGGTACTTNNGGGAGAATAGTGATGCAGCTTTNCACCNTCAC
NGCAATGAGAGGATTCTGAGGCCTTCTGAGNGGAATCAGAGATACCTTGCCAAGTAATATGTACCAGAAAAATGGCTTAC
ATCATGGGAAATACGCAGTGAAGAAATCACGGNNAACTGATGTGGAAGACCTTACTCCAAACCCTAAAAAACTACTTCAG
ATTGGTAATGAGCTGCGCAAGCTGAATAAGGTGATCAGTGACCTGACTCCAGTTAGTGAGCTTCCCTTAACAGCAAGGCC
AAGGTCAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26453

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26894784..26896875 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048249 (A930001N09Rik) NM_029870 RIKEN cDNA A930001N09 gene Gene [Source:MGI Symbol;Acc:MGI:1924378]

 
Come back to gene ENSMUSG00000048249


For any suggestions or comments, please send an email to unitrap@crg.es