Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST116848
Clone ID OST116848
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST116848
Sequence
GACTGAGGTCCAGTGCTCGTGCCACATCACGCTGTCTGGGAAGAGCGCAGGAACTCTTGCAGCAGATCCGACTTGCCCAG
AAAGAAAAAGCAGCCATGGAAGTGGAAGCCCCCTCCAAGTCAACCAGGACTAGTCAGCCACAGCCCAAGCAACAAAAGAA
GATAAAAGCTCCCCAGGACGTAGTTATGGAGGATCTTGAAGATAAGAGCTAAAATCCCTTGCCTNTTCTACCAGAAGATG
GTCAACAGCACTGAGAAAGATTTGGGGGGAACTTTTGGAAAAAATATTAGCATTTTTTCATTTTTCCTAGACACCTTTTT
TTACAGNGGACCCTGACCTCCCTGGGGNGGNGTATATTGGGGGACCGAAGGAGGCCCCAGAGAANGGATTGGGGGGGCCC
C
Sequence Type mRNA
Unitrap ID UNI26454

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 8964487..8965152 209
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071653 (1810009A15Rik) NM_025463 RIKEN cDNA 1810009A15 gene Gene [Source:MGI Symbol;Acc:MGI:1913526]

 
Come back to gene ENSMUSG00000071653


For any suggestions or comments, please send an email to unitrap@crg.es