Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRP157
Clone ID RRP157
Vector pGT0Lxf
Project baygenomics

Sequence tag RRP157
Sequence
TCCCAGACAGATGTTTATGCAGATCATTTGGATTGGCATTATCGGCAAAACAGAACCGAGAAAGATGTTAGCAGAAAAGT
CACTCATAGACGTTGGTACTACAGTCTAACAGATTGGATAGAATTTGAAGAAATAGCTGATCTGGAAGAACGTGCAAAAA
GCCAGTTTTTTGAAAAGGTTCATGAAGAGGTTGTCCTTAAAACTCAGGAGGCTGCTAAAGAAAAGGAGTTCCAAAGTGTA
CCTGCTGGACCAGCTGGAGCAGTTGAGAGTTGTGAAATCTGTCAAGAACAATTTGAACAGTACTGGGATGAAGAGGAGGA
AGAATGGCACTTAAAAAATGCTATTAGAGTAGACGGAAAGATTTACCATCCACTCATGTTATGAAGATTATCAAAAT
Sequence Type mRNA
Unitrap ID UNI7853

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 99794500..99796562 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041328 (Pcf11) NP_083354 cleavage and polyadenylation factor subunit homolog (S. cerevisiae) Gene [Source:MGI (curated);Acc:Pcf11-001]

 
Come back to gene ENSMUSG00000041328


For any suggestions or comments, please send an email to unitrap@crg.es