Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST116738
Clone ID OST116738
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST116738
Sequence
GACATGGTGTTACTGTGGAGTTTATGATAATGCCTTAAACAATGACAACTACAACCTTGCTAGAGGCTTCAATTACCACC
AAGGACCTGAGTGGCTGTGGCCAATTGGGTATTTTCTTCGTGCAAAGTTGTATTTTTCCAAAATGATGGGCCCAGAGACT
GCTGCAGAAGACTGTATNGTTTGGTTAAAAATGTTCTTTCTAGACATTATGTTCATCTTGAGAGATCCCCATGGAAAGGC
CTTCCGGAGCTCACCAATGAGAACGGCCAGTACTGCCCTTTCAGCTGTGAGACACAGGCGTGGTCAATGGCTGNTGTTCT
GGAAACCCTCTATGATTTATAGTTGGCTCATAAATAGTAATTGTGTGAACACTTGACATTATTGAATGCAAGGTCATAAA
GAAATGTA
Sequence Type mRNA
Unitrap ID UNI26456

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 116447670..116449621 185
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033400 (Agl) NM_001081326 amylo-1,6-glucosidase, 4-alpha-glucanotransferase Gene [Source:MGI Symbol;Acc:MGI:1924809]

 
Come back to gene ENSMUSG00000033400


For any suggestions or comments, please send an email to unitrap@crg.es