Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST116638
Clone ID OST116638
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST116638
Sequence
GACTGAGGAAAGGCCTGGAAGAAGAGGCCACCAAACAACCCAACCCTCTCTCCAGTCCCTTGATCTACTCGTCGCCTGCA
TCTGGAGACCCAATGGCCCAAGCCTACTGGCAGTGCTACCCCTGGCTTATTCTCCTCTGTGCATGTGCCTGGAGCTACCC
AGAGCCCAAGTACCTTGGAAGGGAAGATGTGAGAAACTGTTCAACCAGCCCTGAGGC
Sequence Type mRNA
Unitrap ID UNI26460

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 45462236..45464976 136
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037005 (Xpnpep2) NM_133213 X-prolyl aminopeptidase (aminopeptidase P) 2, membrane-bound Gene [Source:MGI (curated);Acc:Xpnpep2-003]

 
Come back to gene ENSMUSG00000037005


For any suggestions or comments, please send an email to unitrap@crg.es