Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST116576
Clone ID OST116576
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST116576
Sequence
GACTGAGGTGGGTTTCTAGCTGCAGGNGAGCCTGNGNAGANTGCCATATNNACTTCTTGGGGNACTCTCATTNGTGGTGA
CAGGAAGCATGGGTGNCNCTATATANCNACNNGCTNTAATCNNAGANNACANGCTCNATNCNTNACANTCTGACCAGNAT
ACCTTTCCCAGTACCCGNCTCCAGCAGGAATTTGCAGCTCCTGACTACCGCTNTTCTCATATTGAAGTTAGCCAGGCATC
ACAGCTTTTACAGCAGCAGCAGCAGCAGCAGCAGCTTCGAAGACGACCTTCCTTGCTTTCAGAATTTCACCCGGGTTCTG
ACAGGCCTNAAGAAAGGNNAACCGGATATNANCAGNNCCACTCAGGANCCTTACCGNTGGATCATGATTCCTTGGAGTAC
A
Sequence Type mRNA
Unitrap ID UNI17971

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 62236493..62251889 137
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018501 (Ncor1) NP_035438 nuclear receptor co-repressor 1 Gene [Source:MGI (curated);Acc:Ncor1-001]

 
Come back to gene ENSMUSG00000018501


For any suggestions or comments, please send an email to unitrap@crg.es