Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST116550
Clone ID OST116550
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST116550
Sequence
ACTGAGGTCCCTTAGGAGGAACCCCTTGAGCTCCCGGTCTAAAACACGTTATCGCCAGTGTGAGGGCTAAATGGTGTGAT
AACACCCAAGAGCCAGGAAATGGCAACAGCCTTGGAGCCAGAGGACCAAGATCTTTGGGAAGAAGAAGGAGTTCTGATGG
TGAAACTGGAGGATGATTTCACGTGCGGGCCAGAATCCGCCTTGGAGGGCGATGATCCTGTACTGGAGACCTCTCACCAG
AACTTCCGACGCTTTCGATACCAGGAAGCATCAAGCCCTCGAGAAGCTCTCATCAGACTTCGAGAGCTTTGTCATCAGTG
GCTGAGGCCAGAGAGGAGAACTAAGGAGCAGATTCTTGAGCTGCTCGTGTTGGAGCAGTTCCTCACTGTCCTGCCTGGAG
AACTGCAGAGCTGGGTGCGAGGCCAGCGGCCCGAGAGTGGCGAGGAGGCAGTGACGCTGGTGGAGG
Sequence Type mRNA
Unitrap ID UNI26463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40014782..40015244 459
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025602 (Zfp202) NM_030713 zinc finger protein 202 Gene [Source:MGI Symbol;Acc:MGI:1933401]

 
Come back to gene ENSMUSG00000025602


For any suggestions or comments, please send an email to unitrap@crg.es