Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST116528
Clone ID OST116528
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST116528
Sequence
GAACTGAGGGATAGCGTGGCCCAGTCGTCTTCTTTGTGGACTATGCAGTCTAACTGCTTATATATGGAAGAAATCGAAGA
CTCGGTGACTGTTCGGGATTATATCCAATCCACTATGGAGACTGAAANGGACCCCCAGNGCCTCTTGGACCTGGCCAGGA
GGATGGNGCNGGTTCTTGGCCGGAATGCACGANCAAGACCTCATTCACGGGGACCTCACCACCTCCAACATGCTCCTGAG
GCGGCCCCTGGCGCAGCTGCACATCGTGCTCATCGACTTTGGGCTGAGCTTTGTCTCAGGACTGCCGGAAGATAAAGGCG
TCGACCTCTATGTCCTGGAGAAGGCCTTCCTCAGCACGCACCCCCACACCGAGACCGAGTTTGAAGCCTTTCTGAAGAGT
TACGGGGCCTCGTCCAAGAAGTCCAGTCCAGNGCTGAAGAAGTTAGATGAGG
Sequence Type mRNA
Unitrap ID UNI26465

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 166620880..166621322 418
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042854 (Trp53rk) NM_023815 transformation related protein 53 regulating kinase Gene [Source:MGI (curated);Acc:Trp53rk-001]

 
Come back to gene ENSMUSG00000042854


For any suggestions or comments, please send an email to unitrap@crg.es