Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRP257
Clone ID RRP257
Vector pGT0Lxf
Project baygenomics

Sequence tag RRP257
Sequence
CAAGATTTAGAGAAGCAAGGGAAAACCGGAAAATGAAAATTGTCCCCTCGCATAAATACATATTTGAAGTTCTAGGAGAA
AAGCTTGGGTTGGACTTAGTAACTGTGGAAGCAATCTATTTTTGGATTACCCGT
Sequence Type mRNA
Unitrap ID UNI7869

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 30772888..30773019 120
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000033826 (Dnahc8) NM_013811 dynein, axonemal, heavy chain 8 Gene [Source:MGI Symbol;Acc:MGI:107714]

 
Come back to gene ENSMUSG00000033826


For any suggestions or comments, please send an email to unitrap@crg.es