Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRP258
Clone ID RRP258
Vector pGT0Lxf
Project baygenomics

Sequence tag RRP258
Sequence
TGTGATGACAGGCAGGTTTGGGCCTGACTTCCCGGGCACCCACTGCCTGGGTGACCTCCTGCAGCTGTCATTTGCATCAT
CTCAGCGGGACCTGTTTGAGGATGGCTGGCTGGAGTTTGTTGTCCGTGTTTACTGGCTGAAGGCACGTTTCTTGGCACTA
CAGGGAGACATGGAACAAGCCTTGGAGAACTATGATATCTGCACAGAAATACTGCAGAGCTCCAGTGCTATCCAAGCCCA
GGCAGGGGCTGAGCAAGGGGACATAGTCATCCGGCTGCCCAACCTTCACAATGACTCCGTTGTCTCTCTGGAGGAA
Sequence Type mRNA
Unitrap ID UNI7870

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 75200956..75202233 162
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020196 (Cabin1) NM_172549 calcineurin binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1298375]

 
Come back to gene ENSMUSG00000020196


For any suggestions or comments, please send an email to unitrap@crg.es