Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ037
Clone ID RRJ037
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ037
Sequence
TTTTTCAACTACGTCGGGTTGGGCCCTGCCGCCATCGCTCTCATGATTCTAGCACTCCTGCTCCTGCTCC
Sequence Type mRNA
Unitrap ID UNI7873

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 20752728..20752792 65
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044393 (Dsg2) NM_007883 desmoglein 2 Gene [Source:MGI (curated);Acc:Dsg2-001]

 
Come back to gene ENSMUSG00000044393


For any suggestions or comments, please send an email to unitrap@crg.es