Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRJ635
Clone ID RRJ635
Vector pGT0Lxf
Project baygenomics

Sequence tag RRJ635
Sequence
AATGGGTATTGGGCGTCACTGTAATAAGTTATTCCTTATTGATTTTGGTTTGGCCATATAAGTACAGAGACAACAGGACA
AGGCAACACATACCATACAGAGAAGATAAAAACCTCACTGGCACTGCCCGATACGCCAGCATCAATGCACATCTTGGTAT
TGAGCAGAGTCGCCGAGATGACATGGAATCTTTAGGATATGTTTTGATGTATTTTAATAGAACCAGTCTGCCGTGGCAAG
GACTGAAGGCTGCAACAAAGAAACAAAAATATGAAAAGATTAGTGAAAAGAAGATGTCCACTCCTGTTGAGGTGTTGTGT
AAGGGGTTTCCTGCAGAATTTGCCATGTACTTAAATTACTGTCGTGGGCTGCGCTTTGAGGAAGCTCCGGATTACATGTA
TCTGAGGCAGCTATTCCGCATCCTTTT
Sequence Type mRNA
Unitrap ID UNI7877

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 61729189..61738424 138
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024576 (Csnk1a1) NM_146087 casein kinase 1, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:1934950]

 
Come back to gene ENSMUSG00000024576


For any suggestions or comments, please send an email to unitrap@crg.es