Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST114860
Clone ID OST114860
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST114860
Sequence
ACTGAGGAGGTGCCCAGACATGGGTGACTGGAGCGCCTTGGGGAAGCTGCTGGACAAGGTCCAAGCCTACTCCACGGCCG
GAGGGAAGGTGTGGCTGTCGGTGCTCTTCATTTTCAGAATCCTGCTCCTGGGGACAGCGGTTGAGTCAGCTTGGGGTGAT
GAACAGTCTGCCTTTCGCTGTAACACTCAACAACCCGGTTGTGAAAATGTCTGCTNTGACAAGTCCTTCCCCATCTCTCA
CGTGCGCTTCTGGGTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI10414

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 56107335..56107588 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000050953 (Gja1) NM_010288 gap junction protein, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:95713]

 
Come back to gene ENSMUSG00000050953


For any suggestions or comments, please send an email to unitrap@crg.es