Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST114775
Clone ID OST114775
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST114775
Sequence
AACTGAGGTTTGCATCTACAGGAAGGTGCCCAAGGACCTCACACAGCCGACATATACTGGTGCCATTATCTCCATCTGCT
GCTGCCTCTTCATCCTCTTCCTCTTCCTGTCGGAGCTCACTGGATTCATCACAACAGAAGTGGTGAATGAGCTCTACGTC
GATGACCCAGACAAGGACAGCGGGAGGCAAAATTGACGTCAGTCTCAACATCAGTTTACCCAATTTGCACTGTGAATTGG
NCGGGCTTGACATCCAAGATGAGATGGGCAGACACGAAGTGGGGCCACATCGACAATTCCATGANNATCCCGCTGAATAA
TGGAGCCCGGCTTGCCGCTTCGAGGGCCAGTTCAGCATCAACAAGGTTCCCGGCAACTTCCATGTGT
Sequence Type mRNA
Unitrap ID UNI1463

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 26745536..26771383 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001576 (Ergic1) NM_026170 endoplasmic reticulum-golgi intermediate compartment (ERGIC) 1 Gene [Source:MGI Symbol;Acc:MGI:1914708]

 
Come back to gene ENSMUSG00000001576


For any suggestions or comments, please send an email to unitrap@crg.es