Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST114734
Clone ID OST114734
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST114734
Sequence
GACTGAGAAATGCATCGTGATTCCTGTCCCTTGGATTGTAAGGTTTATGTAGGTAATCTTGGAAATAATGGAAACAAGAC
TGAATTAGAACGGGCTTTTGGCTATTATGGACCACTCAGAAGTGTGTGGGTTGCTCGAAACCCTCCTGGCTTTGCTTTCG
TCGAATTTGAGGATCCCCGAGATGCTGCTGATGCTGTCCGGGAACTAGATGGAAGAACACTGTGTGGCTGCCGTGTAAGA
GTGGAACTGTCGAATGGTGAAAAGAGAAGTCGGAATCGTGGGCCGCCTCCCTCTTGGGGTCGTCGTCCTCGAGATGATTA
CCGCAGGAGGAGTCCTCCACCTCGGCGCANATCCCCAAGAAGGAGAAGCTTTTCCCGAAGCCGGAGCAGGTCACTTTCTA
GAGATAGGAGAAGAGAAAGGGTCTCTGTCTCGNGAGAGAAATCACAAGCCGGCTCGATCCTTCTCTAGGTCTCGNANCCG
ATCTAGGNCAAATGAAAGGAAATAGAAGACCAG
Sequence Type mRNA
Unitrap ID UNI3589

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 29173184..29178364 210
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000071172 (Sfrs3) NM_013663 splicing factor, arginine/serine-rich 3 (SRp20) Gene [Source:MGI (curated);Acc:Sfrs3-001]

 
Come back to gene ENSMUSG00000071172


For any suggestions or comments, please send an email to unitrap@crg.es