Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM007
Clone ID RRM007
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM007
Sequence
CCTCGCTCCCCCGGCGAGATGGGGACACAGAGAAGGGTCAACCAAGTCGCCCCACTAAGAGCAAGGATGCCCATGTCTGT
GGCCGGTGCTGCGCTGAATTCTTTGAATTATCAGACCTTCTGCTCCATAAAAAGAGCTGCACTAAAAATCAATTAGTTTT
GATTGTCAATGAAAGTCCAGCCTCCCCAGCAAAAACCTTCCCTCCTGGCCCGTCTCTCAATGATCCCGATGACCAAATGA
AAGACGCGGCGAATAAAGCAGACCAAGAAGACTGCAGCGACCTTTCAGAACCCAAGGGGCTTGACAGGGAAGAGTCCATG
GAGGTGGAGGTCCCAGTTGCCACCACCACCACCACCACCACTGGCGGCAGCGGCGGGAGTGGTGGCAGCACTCTGAGCGG
TGTCACCAACATCACCACCCCGAGCTGCCACAGCGGCTCTTCCACGGGTACCTCAGCGATCACAACCTCTCTACCTCAAC
TGGGGGACCTGACGACACTGGGCAACTTCTCGGTGATCAACAGCAACGTCATCATTGAGAATCTCCAGAGCACCA
Sequence Type mRNA
Unitrap ID UNI7886

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 91556764..91566271 529
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031665 (Sall1) NM_021390 sal-like 1 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1889585]

 
Come back to gene ENSMUSG00000031665


For any suggestions or comments, please send an email to unitrap@crg.es