Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM015
Clone ID RRM015
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM015
Sequence
TTTCTGGGAGTTTTTTGGCTGCTCTGCCGGAGCTATGCCGAAAGTCGTGTCGCGGTCGGTGGTCTGCTCAGACACCCGGG
ACCGCGAGGAATATGATGATGGCGAGAAGCCCCTCCATGTCTACTACTGTTTATGTGGCCAGATGGTCCTGGTGCTGGAT
TTCCAGTGAGAGAAATTGCCCATGAGGCCCCGGGTCCGGTCTCGGGTGATACATGCTGCCACACATGCTCTCAAGTTTTG
TAACGCAGAAGATGAGGAGACTATTCATCTTAGGAGGCCTGAGGGCATTGAACGTCAGTACACGAAGAAGTGTGCAAAGC
GTGGACTGCCGCTCTTCTTCCAATCCCAGCGGAAGAATGCTCCTGTGTCCTTCATTGTGGATGGAGCAGTAGTGAAATTC
GGCCAAGGCTTTGGGAAAAGCGATCTATATACTCAGAAACAAGAGCCTCCTTAGAAGGTTATGATGACCAAAAGGACTAA
AGACATGGGCAAGTTCAGCTCTGTTACTGTGTCTACCATTGATGAAGAAGAAGAGGAGATAGAGGCTAGGGAAGTTGCTG
ACTCTTACGCGCAGAATGCCAAAGTGATTGAAAAGCAGCTGGAGCGCAAAGGCATGAGCAAGAGGAGGCTGCAGGAGTT
Sequence Type mRNA
Unitrap ID UNI3864

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 34392635..34404161 156
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006423 (C330007P06Rik) NP_084227 RIKEN cDNA C330007P06 gene Gene [Source:MGI Symbol;Acc:MGI:1924894]

 
Come back to gene ENSMUSG00000006423


For any suggestions or comments, please send an email to unitrap@crg.es