Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM026
Clone ID RRM026
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM026
Sequence
GAGCAGGAGCCTGCAGAAGGCACAGACCAGGCCAGGTTGTCAGCCGACTATGAGAAGGTGGAGTTGCCTTTGGAAGACCA
GGTCGGTGACCTGGAGGCATTGTCGGAGAAGTGTGCTCCTTTGACAACGGAAGTGTTTGATGAGAAGACGGAAGCCCACC
AAGAAGTTGTTGCAGAGGTCCACGTGAGCACCGTGGAGAAGATGACGAAAGGGCAAGGTAGGAGCAGAGGTGGAAGGGGA
TGTGGTGGTGGAAGGATCGGGAGAATCCTTGCCCCCTGAGAAACTGGCTGAGACCCAGGAGGTCCCCCAGGAAGCTGAGC
CTGTGGAGGAGCTGATGAAGACCAAAGAAGTATGCGTCTCTGGGGGTGACCATACTCAGCTGACAGATCTAAGTCCTGAA
GAGAAGATGCTACCCAAACACCCCGAAGGCATTGTCAGTGAGGTGGAGATGCTGTCCTCTCAGGAGAGAATCA
Sequence Type mRNA
Unitrap ID UNI4367

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 5992185..5992656 467
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038587 (Akap12) NM_031185 A kinase (PRKA) anchor protein (gravin) 12 Gene [Source:MGI Symbol;Acc:MGI:1932576]

 
Come back to gene ENSMUSG00000038587


For any suggestions or comments, please send an email to unitrap@crg.es