Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM042
Clone ID RRM042
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM042
Sequence
GCGCCACACGCAGATGTGGGAAGACAAATGAAGGGATTTAGAAGCCAAGTAAATGTCATTGGGAAGGAGAGCTACCACCA
CTGAGTGCTGAACACGAGTAAACTCATTTTTCAGAGTTAAAAAATTATTTAAAAAAACAAGATGGGGACTCCTGGTTCTG
GAAGGAAAAGAACGCCGGTAAAAGATCGATTTTCTGCAGAAGATGAAGCTTTGAGTAACATCTCCAGAGAGGCAGAAGCA
AGGCTAGCAGCAAAGCGGGCCGCCAGGGCAGAAGCAAGAGACATCCGCATGCGGGAACTGGAACGACAGCAGAGAG
Sequence Type mRNA
Unitrap ID UNI7894

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 111022141..111063891 135
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032497 (Lrrfip2) NM_027742 leucine rich repeat (in FLII) interacting protein 2 Gene [Source:MGI Symbol;Acc:MGI:1918518]

 
Come back to gene ENSMUSG00000032497


For any suggestions or comments, please send an email to unitrap@crg.es