Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM055
Clone ID RRM055
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM055
Sequence
AAATGAAGGGTTTGGTTTTGTCATCCTCTCTTTTAAAAGCAAGCCGCCCCCAGGAGTTATTCCTCATAAAATTGGCCGGG
TCATAGACGGAAGTCCAGCTGATCGTTGTGGAGGACTGAAAGTTGGAGATCACATCTCTGCTGTGAATGGGCAGTCCATT
GTCGACCTATCCCATGATAATATTGTTCAGCTCATCAAAGATGCTGGAGTCACCGTCACGCTGACAGTGGTTGCTGAAGA
AGAGCATCATGGTCCACCATCAGGAACAAACTCAGCCAGGCAGAGCCCAGCACTACAGCACAGGCCCATGGGACAAGCAC
AAGCCAACCACATACCTGGGGACAGAATTGCCCTAGAAGGTGAAATTGGGAGAGATGTCTGCAGTTCTTACAGACATTCC
TGGTCTGACCATAAGCACCTTGCACAGCCTGACACTGCAGTGATTTCAGTTGTGGGCAGTCGGCACAAT
Sequence Type mRNA
Unitrap ID UNI7898

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 103824863..103837984 188
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052539 (Magi3) NM_133853 membrane associated guanylate kinase, WW and PDZ domain containing 3 Gene [Source:MGI (curated);Acc:Magi3-002]

 
Come back to gene ENSMUSG00000052539


For any suggestions or comments, please send an email to unitrap@crg.es