Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST113948
Clone ID OST113948
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST113948
Sequence
GTCTGGGGAGCTCCTGCATTAAGTCAGACTGAGATTGATGAGATGCCTGAGGCTGCAGTGAAGTCAACAGCCAACAAATA
CCAAGTCTTTTTTTTTGGGACCCATGAGACGGCATTCCTGGGCCCCAAAGACCTCTTCCCTTATGAGGAATCCAAGNANA
CTACNANCTTTNGANTCTCCAGAAAGGNNACTGNATNAGGTACTCNAGAGAAACAGACAGCAGATCCNACACCCTGGGGN
TANGGANAACACTGACACTAGAANNAAAGGAGGCTGNGCCCACCAGGCCANTGGCTGGAGGAAAGGGGCGGGCCTGGGAT
ATAGCCATCCTGGATTGGGTTCATCAGAGGAGATTGAAGGGCGGATGAGGGGACCTGGGGGG
Sequence Type mRNA
Unitrap ID UNI26506

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 107676110..108664616 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032582 (Rbm6) NM_029169 RNA binding motif protein 6 Gene [Source:MGI Symbol;Acc:MGI:1338037]

 
Come back to gene ENSMUSG00000032582


For any suggestions or comments, please send an email to unitrap@crg.es