Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST113906
Clone ID OST113906
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST113906
Sequence
GACGTCTGGGGAGCTCCTGCATTAAGTCAGACTGAGCGGTCCTGTTGACAGTGTGCTGCATGAGGAGGAAGANGAAGACG
GCCAACCCTGAGAACAACCTGAGCTACTGGAACAATGCCATCACAATGGACTACTTCAACAGACACGCGGTGGAGCTCCC
GAGGGAGATCCAGTCCCTAGAGACCTCAGAGGACCAGCTCTCAGAGCCCCGCTCCCCAGCCAATGGCGACTATCGAGACA
CTGGGATGGTCCTCGTGAACCCCTTCTGCCAGGAAACACTGTTCGTGGGAAACGACCAAGTTTCCGAGATCTAGATGCAG
CAGCCTCCGCTTTGCCACTCCCTATTTTTGTCTCTAAATTATAAATATACAAATATATATATATTATAAATATAACCTTT
GTGTAACCCTGACTTAATAAGAGACATTTTCAGCTTTTTTTCCTAAGAATTGNCAACATCTTTTTTACAAGTGTGG
Sequence Type mRNA
Unitrap ID UNI26507

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 103386831..103391675 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042757 (Tmem108) NM_178638 transmembrane protein 108 Gene [Source:MGI Symbol;Acc:MGI:1932411]

 
Come back to gene ENSMUSG00000042757


For any suggestions or comments, please send an email to unitrap@crg.es