Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone RRM071
Clone ID RRM071
Vector pGT0Lxf
Project baygenomics

Sequence tag RRM071
Sequence
CCTGGTCGTCCGCGCCGTGCGCTCACGTTCCTGGCCTGGCGGTCCTCGAGGCCCGCAGCCACCGCGGATCCGGGCTCGTT
CGGCCCCTCCCAT
Sequence Type mRNA
Unitrap ID UNI7903

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52124722..52124814 93
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038502 (Ptov1) NM_133949 prostate tumor over expressed gene 1 Gene [Source:MGI (curated);Acc:Ptov1-001]

 
Come back to gene ENSMUSG00000038502


For any suggestions or comments, please send an email to unitrap@crg.es