Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST113546
Clone ID OST113546
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST113546
Sequence
GACTGAGCTGCAGAAGNCCCCAACATGGCAAACCTGGAGGAAAGCTTCCCCCGAGGGGGGACACGGAAACTCCACAAATC
AGAGAAGTCTTCCCGGCAGGTGGTTGAACAAGACAACTTATTTGATGTTTCCACAGAAGAAGGTCCCATTAAAAGGAAAA
AGAGCCAGAAAGGGCCAGCAAAAACAAAAAA
Sequence Type mRNA
Unitrap ID UNI10492

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 47167270..47168305 119
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025047 (Pdcd11) NM_011053 programmed cell death 11 Gene [Source:MGI Symbol;Acc:MGI:1341788]

 
Come back to gene ENSMUSG00000025047


For any suggestions or comments, please send an email to unitrap@crg.es