Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST113332
Clone ID OST113332
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST113332
Sequence
ACTGAGGATCCAAACTACTGGATACAGGTGCATCGCTTGGAGCATGGAGATGGAGGGATTCTAGACCTGGATGACATCCT
NTGTGACGTTGCTGATGACAAAGACAGAATACACCTGCCAGATGATTAAAATGNGCCTAATTTANTCAGCATGGGTACTT
GTNCACCAGAGATANTTTNAAGCTAATGTCANGNGACNTCTTCNTCTATCCTGCANAAAATGCTAAAANCATTGAACAGA
GCNGGGNNNCACTTTCAAAAAAATGTTTGNAAGCTNCCCTNGGCTTNCCCCCCAAGNGGATATTTAAAANCCCNCCCCCC
CCCCNTTTTCTTTTCCTTTTNGTTNTGCAANTTAATNNTGATANTCCGTTCTGNAAATGGNACCATGGGGCCTTAAAATT
TTTAATAAAAC
Sequence Type mRNA
Unitrap ID UNI20252

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 129685105..129792064 103
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000025812 (Pard3) NM_033620 par-3 (partitioning defective 3) homolog (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2135608]

 
Come back to gene ENSMUSG00000025812


For any suggestions or comments, please send an email to unitrap@crg.es