Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST113151
Clone ID OST113151
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST113151
Sequence
ACTGAGAGTCAGTCGCTTTGAATCCAAGATCCATGACTTGCGGGAACAAATGATGAACAGCAGCATGAGTTCTGGGTCTG
GGTCTCTNCGAACCAGTGAGAAGAGGTCCTTGTATGTCAGGGCCCTGTTTGATTATGATCGGACTCGTGACAGCTGTCTA
CCAAGCCAGGGACTCAGTTTCTCTTATGGGTGACATTCTGCACCGTCATTAACGCCTCTTGAT
Sequence Type mRNA
Unitrap ID UNI20160

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 97992023..98001947 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000000881 (Dlg3) NM_016747 discs, large homolog 3 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg3-003]

 
Come back to gene ENSMUSG00000000881


For any suggestions or comments, please send an email to unitrap@crg.es