Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone OST113035
Clone ID OST113035
Vector iBf-Geo pA/Pgk IBtk
Project lexicon
Note ES cell clones are being distributed through the Texas Institute of Genomic Medicine (TIGM)

Sequence tag OST113035
Sequence
ACTGACAACAGCCCTTCTGGGGACAGTGACTGCTACATGAACTACAGGAGTGTCGACCAGGACTCTCAGCCCGTCTATTG
CAACCTGGAGTCCCTGGGGCGATGAGGAGAGTGTGGTCTCCTGGCGCTGAACCAGCCTCCAACAGCCCCCAGGATCCAGC
ACGCTCAACATCACAGGGGGTAGAGGACACCCCACCCCACCCAGAGCAGAAGGAGGGTGAGAAACAACCCTCCGGTCAGN
GNGCATGCATGTGATGCTCAATAAAAGCTCTGGGAGCAGCTGACTCTAAAAAAAAAAA
Sequence Type mRNA
Unitrap ID UNI26525

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 73144464..73144750 257
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000049988 (Lrrc25) NM_153074 leucine rich repeat containing 25 Gene [Source:MGI Symbol;Acc:MGI:2445284]

 
Come back to gene ENSMUSG00000049988


For any suggestions or comments, please send an email to unitrap@crg.es